Mutants (Isolated)

tm5848

Allele Nametm5848
Sequence NameW03G9.7
CGC NameW03G9.7
Worm BaseAllele Name tm5848
CGC Name W03G9.7
Sequence W03G9.7
Phenotypehomozygous viable.
Mutation site34484/34485-34802/34803 (318 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(32806..33249, 33308..33475, 33644..33839, 33899..34041, 34279..34591, 34667..34812, 34858..35043, 35197..35247))
Map position-0.43
Balancer
Map position of balancer
Sequence of primersIntRev:CACATCTCCATGGCTCCGAG,IntFwd:GGTGGCCTTGTGTGTGCACA,ExtRev:GCTGGGCGTCTCCTAGGTTT,ExtFwd:CAGCGGCGAAATAACGACCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Maguire JE, Silva M, Nguyen KC, Hellen E, Kern AD, Hall DH, Barr MM.
Myristoylated CIL-7 regulates ciliary extracellular vesicle biogenesis.
Mol Biol Cell 2015 26(15) 2823-32 
[ PubMed ID = 26041936 ] [ RRC reference ]