Mutants (Isolated)

tm584

Allele Nametm584
Sequence NameT21C9.2
CGC Namevps-54
Worm BaseAllele Name tm584
CGC Name vps-54
Sequence T21C9.2
Phenotypehomozygous viable. Dr. G. Hermann: WT gut granules.
Mutation site2220/2221-2839/2840 (619 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(446..548, 595..1000, 1024..1238, 1292..2886, 2934..3086, 4810..4914, 4965..5145, 9236..9475, 9998..10197))
Map position2.6
Balancer
Map position of balancer
Sequence of primersExtRev:GACTCAAAGCTCATTGAGCT,ExtFwd:AGTAATTCCACAACTCGCGA,IntFwd:GCGAATTCCAGTCTTGGGAA,IntRev:GAGCGCCAAGTGATCATGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hermann GJ, Schroeder LK, Hieb CA, Kershner AM, Rabbitts BM, Fonarev P, Grant BD, Priess JR.
Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.
Mol. Biol. Cell 2005 16(7) 3273-88 
[ PubMed ID = 15843430 ] [ RRC reference ]