Mutants (Isolated)

tm5790

Allele Nametm5790
Allele TypeNormal
Sequence NameF38A5.1
Gene Nameodr-8
Worm BaseAllele Name tm5790
Gene Name odr-8
Sequence F38A5.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1385/1386-CAAA-2385/2386 (1000 bp deletion + 4 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(61..211, 262..430, 476..572, 618..799, 1075..1224, 1272..1371, 1419..1576, 1623..1719, 1765..1959, 2011..2192, 2237..2411, 2568..2681))
Map position3.21
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGGGTCTGTCAAGTTGGCA,IntFwd:GTTGGTCAAACGAGCACTCT,ExtRev:CCATATTCAGCTCGCTGGTC,IntRev:TTGGACCAACTCAGATGGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Colin E, Daniel J, Ziegler A, Wakim J, Scrivo A, Haack TB, Khiati S, Denommé AS, Amati-Bonneau P, Charif M, Procaccio V, Reynier P, Aleck KA, Botto LD, Herper CL, Kaiser CS, Nabbout R, N'Guyen S, Mora-Lorca JA, Assmann B, Christ S, Meitinger T, Strom TM, Prokisch H, FREX Consortium, Miranda-Vizuete A, Hoffmann GF, Lenaers G, Bomont P, Liebau E, Bonneau D.
Biallelic Variants in UBA5 Reveal that Disruption of the UFM1 Cascade Can Result in Early-Onset Encephalopathy.
Am J Hum Genet 2016 99(3) 695-703 
[ PubMed ID = 27545681 ] [ RRC reference ]