Mutants (Isolated)

tm5755

Allele Name

tm5755

Sequence Name

ZK593.6

CGC Name

lgg-2

Worm Base

Allele Name

tm5755

CGC Name

lgg-2

Sequence

ZK593.6

Phenotype

homozygous viable.

Mutation site

24861/24862-25213/25214 (352 bp deletion)

Chromosome

Putative gene structure

complement(join(24970..25123, 25175..25343, 25962..26031))

Map position

4.75

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GAGACTAGCCAAGTACACAG,IntRev:GTCAGAGACGCAGAGGACAG,ExtRev:TCACCCGTCCATTGTAAAAG,IntFwd:ACGGGCTGGAAAATGCGGAG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Papandreou ME, Tavernarakis N.
Monitoring Autophagic Responses in Caenorhabditis elegans.
Methods Enzymol 2016 588 429-444
[ PubMed ID = 28237114 ] [ RRC reference ]

Fazeli G, Trinkwalder M, Irmisch L, Wehman AM.
C. elegans midbodies are released, phagocytosed and undergo LC3-dependent degradation independent of macroautophagy.
J Cell Sci. 2016 129(20) 3721-3731.
[ PubMed ID = -1 ] [ RRC reference ]

Jenzer C, Manil-Ségalen M, Lefebvre C, Largeau C, Glatigny A, Legouis R.
Human GABARAP can restore autophagosome biogenesis in a C. elegans lgg-1 mutant.
Autophagy 2014 10(10) 1868-72
[ PubMed ID = 25126728 ] [ RRC reference ]

Jenzer C, Simionato E, Largeau C, Scarcelli V, Lefebvre C, Legouis R.
Autophagy mediates phosphatidylserine exposure and phagosome degradation during apoptosis through specific functions of GABARAP/LGG-1 and LC3/LGG-2.
Autophagy 2019 15(2) 228-241
[ PubMed ID = 30160610 ] [ RRC reference ]

Palikaras K, Mari M, Petanidou B, Pasparaki A, Filippidis G, Tavernarakis N.
Ectopic fat deposition contributes to age-associated pathology in Caenorhabditis elegans.
J Lipid Res 2017 58(1) 72-80
[ PubMed ID = 27884963 ] [ RRC reference ]

Manil-Ségalen M, Lefebvre C, Jenzer C, Trichet M, Boulogne C, Satiat-Jeunemaitre B, Legouis R.
The C. elegans LC3 acts downstream of GABARAP to degrade autophagosomes by interacting with the HOPS subunit VPS39.
Dev Cell 2014 28(1) 43-55
[ PubMed ID = 24374177 ] [ RRC reference ]

Djeddi A, Al Rawi S, Deuve JL, Perrois C, Liu YY, Russeau M, Sachse M, Galy V.
Sperm-inherited organelle clearance in C. elegans relies on LC3-dependent autophagosome targeting to the pericentrosomal area.
Development 2015 142(9) 1705-16
[ PubMed ID = 25922527 ] [ RRC reference ]

Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev Cell 2016 38(2) 171-85
[ PubMed ID = 27396362 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)
[ PubMed ID = 28867808 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev Biol 2019 447(1) 103-125
[ PubMed ID = 29709599 ] [ RRC reference ]