Mutants (Isolated)

tm574

Allele Nametm574
Sequence NameT07G12.10
CGC Namezim-2
Worm BaseAllele Name tm574
CGC Name zim-2
Sequence T07G12.10
Phenotypehomozygous viable, Dr. A. Dernburg: Dev. Cell 11, 817 (2006). Dr. W. Hanna-Rose: Genetics 177, 1221 (2007).
Mutation site27386/27387-27801/27802 (415 bp deletion)
ChromosomeIV
Putative gene structurejoin(27217..27315, 27378..28168, 28467..28746, 28819..29079, 29171..29364, 29416..29468, 29516..29592)
Map position4.62
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCCGTTTCATTTGGAACTT,ExtRev:TGTCGAGTTGTCTGGCATGA,IntFwd:GCTGCTGCCCATTTTCGATA,IntRev:GACAACGCGGCAAAACAACT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Muscat CC, Torre-Santiago KM, Tran MV, Powers JA, Wignall SM.
Kinetochore-independent chromosome segregation driven by lateral microtubule bundles.
Elife 2015 4 e06462 
[ PubMed ID = 26026148 ] [ RRC reference ]

Gu SG, Fire A.
Partitioning the C. elegans genome by nucleosome modification, occupancy, and positioning.
Chromosoma 2010 119(1) 73-87 
[ PubMed ID = 19705140 ] [ RRC reference ]

Jaramillo-Lambert A, Engebrecht J.
A single unpaired and transcriptionally silenced X chromosome locally precludes checkpoint signaling in the Caenorhabditis elegans germ line.
Genetics 2010 184(3) 613-28 
[ PubMed ID = 20008570 ] [ RRC reference ]

Sato-Carlton A, Nakamura-Tabuchi C, Chartrand SK, Uchino T, Carlton PM.
Phosphorylation of the synaptonemal complex protein SYP-1 promotes meiotic chromosome segregation.
J. Cell Biol. 2018 217(2) 555-570 
[ PubMed ID = 29222184 ] [ RRC reference ]

Turcotte CA, Sloat SA, Rigothi JA, Rosenkranse E, Northrup AL, Andrews NP, Checchi PM.
Maintenance of Genome Integrity by Mi2 Homologs CHD-3 and LET-418 in Caenorhabditis elegans.
Genetics 2018 208(3) 991-1007 
[ PubMed ID = 29339410 ] [ RRC reference ]

Bessler JB, Andersen EC, Villeneuve AM.
Differential localization and independent acquisition of the H3K9me2 and H3K9me3 chromatin modifications in the Caenorhabditis elegans adult germ line.
PLoS Genet. 2010 6(1) e1000830 
[ PubMed ID = 20107519 ] [ RRC reference ]

Leopold LE, Heestand BN, Seong S, Shtessel L, Ahmed S.
Lack of pairing during meiosis triggers multigenerational transgene silencing in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(20) E2667-76 
[ PubMed ID = 25941370 ] [ RRC reference ]

Jaramillo-Lambert A, Harigaya Y, Vitt J, Villeneuve A, Engebrecht J.
Meiotic errors activate checkpoints that improve gamete quality without triggering apoptosis in male germ cells.
Curr. Biol. 2010 20(23) 2078-89 
[ PubMed ID = 20970339 ] [ RRC reference ]

Phillips CM, Meng X, Zhang L, Chretien JH, Urnov FD, Dernburg AF.
Identification of chromosome sequence motifs that mediate meiotic pairing and synapsis in C. elegans.
Nat. Cell Biol. 2009 11(8) 934-42 
[ PubMed ID = 19620970 ] [ RRC reference ]

Phillips CM, Dernburg AF.
A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans.
Dev. Cell 2006 11(6) 817-29 
[ PubMed ID = 17141157 ] [ RRC reference ]

Sun H, Nelms BL, Sleiman SF, Chamberlin HM, Hanna-Rose W.
Modulation of Caenorhabditis elegans transcription factor activity by HIM-8 and the related Zinc-Finger ZIM proteins.
Genetics 2007 177(2) 1221-6 
[ PubMed ID = 17720937 ] [ RRC reference ]

Checchi PM, Engebrecht J.
Caenorhabditis elegans histone methyltransferase MET-2 shields the male X chromosome from checkpoint machinery and mediates meiotic sex chromosome inactivation.
PLoS Genet. 2011 7(9) e1002267 
[ PubMed ID = 21909284 ] [ RRC reference ]

Arur S, Ohmachi M, Nayak S, Hayes M, Miranda A, Hay A, Golden A, Schedl T.
Multiple ERK substrates execute single biological processes in Caenorhabditis elegans germ-line development.
Proc. Natl. Acad. Sci. U.S.A. 2009 106(12) 4776-81 
[ PubMed ID = 19264959 ] [ RRC reference ]

Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF.
Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint.
PLoS Genet. 2013 9(8) e1003679 
[ PubMed ID = 23990794 ] [ RRC reference ]