Mutants (Isolated)

tm570

Allele Nametm570
Sequence NameT03F6.2
CGC Namednj-17
Worm BaseAllele Name tm570
CGC Name dnj-17
Sequence T03F6.2
Phenotypehomozygous viable. Dr. C. Rongo: normal GLR-1::GFP localization and expression.
Mutation site30375/30376-GTTTTCATATCCTTGATAGCAAGAAGCTGAAAAA-30940/30941 (565 bp deletion + 34 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(28836..29077, 29134..29441, 30194..30364, 30412..30542, 30597..30890, 30935..31248, 31720..31792))
Map position21.21
Balancer
Map position of balancer
Sequence of primersIntFwd:CGAATACCTCACGGCATTTA,IntRev:CGAAGAGTGTACTCAGCAAT,ExtRev:AAAAATCCGGATCGCATCGA,ExtFwd:AACCTGGTCCGGCTATCGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Takayanagi-Kiya S, Jin Y.
Altered Function of the DnaJ Family Cochaperone DNJ-17 Modulates Locomotor Circuit Activity in a Caenorhabditis elegans Seizure Model.
G3 (Bethesda) 2016 6(7) 2165-71 
[ PubMed ID = 27185401 ] [ RRC reference ]