Home > Mutants (Isolated) > tm5659

Mutants (Isolated)

Allele Name		tm5659
Sequence Name		C02H7.3
CGC Name		aex-3
Worm Base	Allele Name	tm5659
	CGC Name	aex-3
	Sequence	C02H7.3
Phenotype		homozygous viable.
Mutation site		27221/27222-27510/27511 (289 bp deletion)
Chromosome		X
Putative gene structure		complement(join(20867..20944, 21084..21130, 21181..21295, 21601..21903, 22673..22997, 23042..23162, 23209..23722, 23888..24082, 24135..24318, 24395..24642, 24734..25101, 25152..25299, 25350..25649, 25697..25819, 25926..26234, 26286..26438, 26628..26775, 26825..26965, 27038..27215, 27459..27687))
Map position		-19.5
Balancer
Map position of balancer
Sequence of primers		IntRev:CTTGCACCAATGTACCTATC,IntFwd:TGCTCGGCGGATGGCATGTA,ExtRev:TGTCCAGGCTTGCACCAATG,ExtFwd:GACATCTGACGGGAGCTCTC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S. Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans. Sci Rep 2016 6 28198  [ PubMed ID = 27306325 ] [ RRC reference ]