Mutants (Isolated)

tm5659

Allele Nametm5659
Sequence NameC02H7.3
CGC Nameaex-3
Worm BaseAllele Name tm5659
CGC Name aex-3
Sequence C02H7.3
Phenotypehomozygous viable.
Mutation site27221/27222-27510/27511 (289 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(20867..20944, 21084..21130, 21181..21295, 21601..21903, 22673..22997, 23042..23162, 23209..23722, 23888..24082, 24135..24318, 24395..24642, 24734..25101, 25152..25299, 25350..25649, 25697..25819, 25926..26234, 26286..26438, 26628..26775, 26825..26965, 27038..27215, 27459..27687))
Map position-19.5
Balancer
Map position of balancer
Sequence of primersIntRev:CTTGCACCAATGTACCTATC,IntFwd:TGCTCGGCGGATGGCATGTA,ExtRev:TGTCCAGGCTTGCACCAATG,ExtFwd:GACATCTGACGGGAGCTCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]