Mutants (Isolated)

tm563

Allele Nametm563
Sequence NameK01B6.1
CGC Namefozi-1
Worm BaseAllele Name tm563
CGC Name fozi-1
Sequence K01B6.1
Phenotypehomozygous viable. Dr. J. Liu: Development 134, 19-29 (2007)
Mutation site18494/18495-19039/19040 (545 bp deletion)
ChromosomeIII
Putative gene structurejoin(18095..18304, 18598..18813, 18870..19128, 19193..19388, 19490..19589, 19637..20683, 20736..20906)
Map position0.39
Balancer
Map position of balancer
Sequence of primersIntRev:GCAGTGGGCTTCCAAGATAT,ExtFwd:CTGCAGCAGCTCCCGGAAAT,ExtRev:TGGAGAGTGAGCATCAAGAT,IntFwd:GCTTTAGTGAAGCAGGTAAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Johnston RJ Jr, Copeland JW, Fasnacht M, Etchberger JF, Liu J, Honig B, Hobert O.
An unusual Zn-finger/FH2 domain protein controls a left/right asymmetric neuronal fate decision in C. elegans.
Development 2006 133(17) 3317-28 
[ PubMed ID = 16887832 ] [ RRC reference ]

Goldsmith AD, Sarin S, Lockery S, Hobert O.
Developmental control of lateralized neuron size in the nematode Caenorhabditis elegans.
Neural Dev 2010 5 33 
[ PubMed ID = 21122110 ] [ RRC reference ]