Mutants (Isolated)

tm5627

Allele Nametm5627
Sequence NameF01G4.3
CGC NameF01G4.3
Worm BaseAllele Name tm5627
CGC Name F01G4.3
Sequence F01G4.3
Phenotypehomozygous viable.
Mutation site13569/13570-ACAAGTC-13998/13999 (429 bp deletion + 7 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(7878..8081, 8133..8267, 8316..8648, 9142..9367, 9420..9631, 9680..9760, 10292..10816, 11328..11453, 11501..11892, 12365..12668, 12718..12970, 13349..13494, 13542..13954, 14001..14179, 14228..14481))
Map position4.9
Balancer
Map position of balancer
Sequence of primersIntFwd:GATCCAGAGAGAAGGGATAC,ExtRev:ACTCTGAACTGGCCACCATG,IntRev:GCCACCATGTGCTCCTATAC,ExtFwd:ATAACGATTCACCTCGTTCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Vohra M, Lemieux GA, Lin L, Ashrafi K.
The beneficial effects of dietary restriction on learning are distinct from its effects on longevity and mediated by depletion of a neuroinhibitory metabolite.
PLoS Biol. 2017 15(8) e2002032 
[ PubMed ID = 28763436 ] [ RRC reference ]