Mutants (Isolated)

tm5624

Allele Nametm5624
Sequence NameF10B5.9
CGC NameF10B5.9
Worm BaseAllele Name tm5624
CGC Name F10B5.9
Sequence F10B5.9
Phenotypehomozygous viable.
Mutation site18097/18098-CTCTCTTAATCT-18428/18429 (331 bp deletion + 12 bp insertion)
ChromosomeII
Putative gene structurejoin(18239..18360, 18418..18589, 18634..18870)
Map position0.72
Balancer
Map position of balancer
Sequence of primersIntFwd:AGACGACGCCAATGCACCTT,IntRev:GGCCAGATATCTGCATTAGA,ExtFwd:GTTCGAAGCGTGTGGTGTGT,ExtRev:GGCTTAGGAGGTTTACGGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li C, Jensen VL, Park K, Kennedy J, Garcia-Gonzalo FR, Romani M, De Mori R, Bruel AL, Gaillard D, Doray B, Lopez E, Rivière JB, Faivre L, Thauvin-Robinet C, Reiter JF, Blacque OE, Valente EM, Leroux MR.
MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone.
PLoS Biol 2016 14(3) e1002416 
[ PubMed ID = 26982032 ] [ RRC reference ]