Home > Mutants (Isolated) > tm5615

Mutants (Isolated)

Allele Name		tm5615
Allele Type		Balanced
Sequence Name		D2085.4
Gene Name		D2085.4
Worm Base	Allele Name	tm5615
	Gene Name	D2085.4
	Sequence	D2085.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		24950/24951-25367/25368 (417 bp deletion)
Chromosome		II
Putative gene structure		join(24448..24648, 24709..24926, 24980..25166, 25217..25350, 25397..25737, 25788..25887, 25934..26222, 26276..26457, 26513..26835, 27019..27284, 27335..27538, 27609..27707, 28064..28311, 28360..28432, 28479..28619)
Map position		0.84
Balancer		mIn1 [e128 mIs14]
Map position of balancer
Sequence of primers		IntFwd:ACGGTGATGTTCGGAGGGAC,ExtFwd:CCGGGTCTTGTTATGACTGA,IntRev:CTTACGCCTCCACAAAGGTG,ExtRev:GGGCGATGAAAGCGTAAAGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Spike CA, Tsukamoto T, Greenstein D. Ubiquitin ligases and a processive proteasome facilitate protein clearance during the oocyte-to-embryo transition in Caenorhabditis elegans. Genetics 2022 221(1)   [ PubMed ID = 35377419 ] [ RRC reference ] Wang R, Kaul Z, Ambardekar C, Yamamoto TG, Kavdia K, Kodali K, High AA, Kitagawa R. HECT-E3 ligase ETC-1 regulates securin and cyclin B1 cytoplasmic abundance to promote timely anaphase during meiosis in C. elegans. Development 2013 140(10) 2149-59  [ PubMed ID = 23578927 ] [ RRC reference ]