Mutants (Isolated)

tm5615

Allele Nametm5615
Sequence NameD2085.4
CGC NameD2085.4
Worm BaseAllele Name tm5615
CGC Name D2085.4
Sequence D2085.4
PhenotypeLet or Ste.
Mutation site24950/24951-25367/25368 (417 bp deletion)
ChromosomeII
Putative gene structurejoin(24448..24648, 24709..24926, 24980..25166, 25217..25350, 25397..25737, 25788..25887, 25934..26222, 26276..26457, 26513..26835, 27019..27284, 27335..27538, 27609..27707, 28064..28311, 28360..28432, 28479..28619)
Map position0.84
Balancer
Map position of balancer
Sequence of primersExtRev:GGGCGATGAAAGCGTAAAGA,IntRev:CTTACGCCTCCACAAAGGTG,ExtFwd:CCGGGTCTTGTTATGACTGA,IntFwd:ACGGTGATGTTCGGAGGGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang R, Kaul Z, Ambardekar C, Yamamoto TG, Kavdia K, Kodali K, High AA, Kitagawa R.
HECT-E3 ligase ETC-1 regulates securin and cyclin B1 cytoplasmic abundance to promote timely anaphase during meiosis in C. elegans.
Development 2013 140(10) 2149-59 
[ PubMed ID = 23578927 ] [ RRC reference ]