Mutants (Isolated)

tm5601

Allele Nametm5601
Sequence NameW02B9.1
CGC Namehmr-1
Worm BaseAllele Name tm5601
CGC Name hmr-1
Sequence W02B9.1
PhenotypeLet or Ste.
Mutation site10643/10644-11174/11175 (531 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(7287..7538, 8393..8875, 9967..10368, 11032..11713, 12500..13020, 14504..14980, 17641..17878, 18608..18767, 19327..19460, 24714..25036))
Map position6.61
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:CCGGGAATGCAATGCGTGGA,IntFwd:GTAGTTCCTAGCCTAAGGCT,ExtRev:GATGCCAGGGAACAACTAGA,IntRev:CGACGTACGGTTTCGAACTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Von Stetina SE, Mango SE.
PAR-6, but not E-cadherin and β-integrin, is necessary for epithelial polarization in C. elegans.
Dev. Biol. 2015 403(1) 5-14 
[ PubMed ID = 25773364 ] [ RRC reference ]