Mutants (Isolated)

tm554

Allele Nametm554
Allele TypeNormal
Sequence NameF55H12.6
Gene Nameztf-26
Worm BaseAllele Name tm554
Gene Name ztf-26
Sequence F55H12.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [F29D10] 19849/19849-GCTC-[F29D10] 20293/20294 (445 bp deletion)
ChromosomeI
Putative gene structurejoin(complement(3001..3157), complement(2646..2720), complement(2249..2404), complement(Z75952.1:20235..20372), complement(Z75952.1:19877..20029), complement(Z75952.1:19561..19802))
Map position3.24
Balancer
Map position of balancer
Sequence of primersIntRev:GCAAACATCCGAACGTTCTT,IntFwd:GTTCCCGCATGAGAAATTGA,ExtFwd:TCACGACTGTTCCAGTAGAT,ExtRev:GTTTCATCCGACATCTTCGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ray AK, Priya A, Malik MZ, Thanaraj TA, Singh AK, Mago P, Ghosh C, Shalimar, Tandon R, Chaturvedi R.
A bioinformatics approach to elucidate conserved genes and pathways in C. elegans as an animal model for cardiovascular research.
Sci Rep 2024 14(1) 7471 
[ PubMed ID = 38553458 ] [ RRC reference ]