Mutants (Isolated)

tm5517

Allele Nametm5517
Sequence NameC18A3.4
CGC NameC18A3.4
Worm BaseAllele Name tm5517
CGC Name C18A3.4
Sequence C18A3.4
Phenotypehomozygous viable.
Mutation site8557/8558-8989/8990 (432 bp deletion)
ChromosomeII
Putative gene structurejoin(8699..8807, 8973..9127, 9178..9416, 9466..9576, 9852..9942, 9991..10305)
Map position-0.96
Balancer
Map position of balancer
Sequence of primersIntRev:CAAGGCCCTGATCTTGATAT,IntFwd:TGTGGACGACGTGTACTGGA,ExtRev:AATTACTCACACAAGGCCCT,ExtFwd:GACACCCTTGCTCCGCACAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Olivier-Mason A, Wojtyniak M, Bowie RV, Nechipurenko IV, Blacque OE, Sengupta P.
Transmembrane protein OSTA-1 shapes sensory cilia morphology via regulation of intracellular membrane trafficking in C. elegans.
Development 2013 140(7) 1560-72 
[ PubMed ID = 23482491 ] [ RRC reference ]