Home > Mutants (Isolated) > tm5504

Mutants (Isolated)

Allele Name		tm5504
Allele Type		Normal
Sequence Name		T19B4.7
Gene Name		unc-40
Worm Base	Allele Name	tm5504
	Gene Name	unc-40
	Sequence	T19B4.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		10426/10427-11169/11170 (743 bp deletion)
Chromosome		I
Putative gene structure		complement(join(6205..6318, 6660..7130, 7186..7286, 8123..8212, 8262..8645, 8694..9661, 10104..10462, 10517..10680, 10730..11050, 11515..11624, 11716..12166, 12412..12552, 12820..12880, 12959..13187, 15259..15439, 16977..17060, 17261..17279))
Map position		0.31
Balancer
Map position of balancer
Sequence of primers		ExtRev:CAAGGCGACGAATTCTTACT,IntRev:GCCTTGTTGCCTCACTAATC,ExtFwd:ATACTCTCTAGCAGTGGCGT,IntFwd:GGCGTCAATCACAAGAGTAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Yee C, Florica R, Fillingham J, Killeen MT. ENU-3 functions in an UNC-6/netrin dependent pathway parallel to UNC-40/DCC/frazzled for outgrowth and guidance of the touch receptor neurons in C. elegans. Dev Dyn 2014 243(3) 459-67  [ PubMed ID = 24123761 ] [ RRC reference ] Tian C, Shi H, Xiong S, Hu F, Xiong WC, Liu J. The neogenin/DCC homolog UNC-40 promotes BMP signaling via the RGM protein DRAG-1 in C. elegans. Development 2013 140(19) 4070-80  [ PubMed ID = 24004951 ] [ RRC reference ] Xu Y, Taru H, Jin Y, Quinn CC. SYD-1C, UNC-40 (DCC) and SAX-3 (Robo) function interdependently to promote axon guidance by regulating the MIG-2 GTPase. PLoS Genet 2015 11(4) e1005185  [ PubMed ID = 25876065 ] [ RRC reference ]