Mutants (Isolated)

tm548

Allele Nametm548
Sequence NameF25D7.3
CGC Nameblmp-1
Worm BaseAllele Name tm548
CGC Name blmp-1
Sequence F25D7.3
Phenotypehomozygous viable. Dr. K. Ashrafi: healthy, fertile, has a small body size and altered fat content at adult stage. Dr. R. Plasterk: Dpy appearance. Dr. R.H. Horvitz: not synMuv with class A or B mutations and not a synMuv suppressor. Dr. M. Hengartner: very slight increase in germ cell apoptosis. Dr. W. Vermeulen: Gro, Dpy, Pvl. Dr. Y-C. Wu: slightly Unc, mild Dpy, abnormal gonad morphology. Dr. O. Blacque: Dyf (+), wild-type localization of ODR-10 to AWB cilium. Dr. C. Yang: no obvious cell death defects. Dr. J. Kaplan: Sma, abnormal gonad.
Mutation site19893/19894-20703/20704 (810 bp deletion)
ChromosomeI
Putative gene structurejoin(18588..18765,19099..19193,19455..20322,20833..21179, 21562..21656, 21707..22175, 22591..22638, 22722..23075)
Map position4.99
Balancer
Map position of balancer
Sequence of primersIntRev:CAGTTATTGCGGCTGTTGTT,ExtRev:CGGATCTTCCACCAGTGGCA,IntFwd:GCGTCAGGTAAGTTGTGATA,ExtFwd:CGTCACCTGCCGGAGTTTCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Nelson MD, Zhou E, Kiontke K, Fradin H, Maldonado G, Martin D, Shah K, Fitch DH.
A bow-tie genetic architecture for morphogenesis suggested by a genome-wide RNAi screen in Caenorhabditis elegans.
PLoS Genet. 2011 7(3) e1002010 
[ PubMed ID = 21408209 ] [ RRC reference ]

Huang TF, Cho CY, Cheng YT, Huang JW, Wu YZ, Yeh AY, Nishiwaki K, Chang SC, Wu YC.
BLMP-1/Blimp-1 regulates the spatiotemporal cell migration pattern in C. elegans.
PLoS Genet. 2014 10(6) e1004428 
[ PubMed ID = 24968003 ] [ RRC reference ]

Padmanabha D, Padilla PA, You YJ, Baker KD.
A HIF-independent mediator of transcriptional responses to oxygen deprivation in Caenorhabditis elegans.
Genetics 2015 199(3) 739-48 
[ PubMed ID = 25552276 ] [ RRC reference ]

Horn M, Geisen C, Cermak L, Becker B, Nakamura S, Klein C, Pagano M, Antebi A.
DRE-1/FBXO11-dependent degradation of BLMP-1/BLIMP-1 governs C. elegans developmental timing and maturation.
Dev. Cell 2014 28(6) 697-710 
[ PubMed ID = 24613396 ] [ RRC reference ]