Mutants (Isolated)

tm5475

Allele Nametm5475
Sequence NameY37D8A.22
CGC Nameepg-3
Worm BaseAllele Name tm5475
CGC Name epg-3
Sequence Y37D8A.22
PhenotypeLet or Ste.
Mutation site119454/119455-119749/119750 (295 bp deletion)
ChromosomeIII
Putative gene structurejoin(117805..117893, 119161..119598, 120731..121160, 122156..122221, 122271..122369, 123486..123620, 123739..123858)
Map position20.61
Balancer
Map position of balancer
Sequence of primersIntRev:TCGTCTGAATGAGCCGCTTC,ExtRev:CTGGCCAAACTGTGTGTACT,IntFwd:ATGGACCGTAATCACCGAGA,ExtFwd:TGCGCGTCAAATATGCGGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev Cell 2016 38(2) 171-85 
[ PubMed ID = 27396362 ] [ RRC reference ]