Mutants (Isolated)

tm547

Allele Nametm547
Sequence NameF15C11.1
CGC Namesem-4
Worm BaseAllele Name tm547
CGC Name sem-4
Sequence F15C11.1
Phenotypelethal or sterile
Mutation site22258/22259-22832/22833 (574 bp deletion)
ChromosomeI
Putative gene structurejoin(15314..15389, 20091..20239, 20990..21088, 21474..21584, 21866..22181, 22422..23028, 23454..23594, 23663..24000, 24186..24293, 24351..24640)
Map position1.65
BalancerhT2
Map position of balancer
Sequence of primersIntRev:GAGGTTGCGTGAGAGAATTC,ExtRev:GAGTTGGCATAACCCGTGGA,IntFwd:CTTTTGTGCCAGCCATAACT,ExtFwd:CGCTTCTTATGGGAAATGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Shen Q, Shi H, Tian C, Ghai V, Liu J.
The C. elegans Spalt-like protein SEM-4 functions through the SoxC transcription factor SEM-2 to promote a proliferative blast cell fate in the postembryonic mesoderm.
Dev Biol 2017 429(1) 335-342 
[ PubMed ID = 28614700 ] [ RRC reference ]