Mutants (Isolated)

tm5460

Allele Nametm5460
Sequence NameW01D2.5
CGC NameW01D2.5
Worm BaseAllele Name tm5460
CGC Name W01D2.5
Sequence W01D2.5
Phenotypehomozygous viable.
Mutation site12603/12604-CTTTGCCTATCGCTAATTC-12969/12970 (366 bp deletion + 19 bp insertion)
ChromosomeII
Putative gene structurejoin(12426..12549, 12912..13066, 13123..13361, 13429..13624, 13672..13831, 13881..14053)
Map position23.52
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCTCGCGGTCATCGTATTA,ExtRev:AGGCGTCGAACATCGCATTG,IntFwd:TCACGCATAGTTAAACCTCC,IntRev:GACGTGGAGCCAAAAGCCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Olivier-Mason A, Wojtyniak M, Bowie RV, Nechipurenko IV, Blacque OE, Sengupta P.
Transmembrane protein OSTA-1 shapes sensory cilia morphology via regulation of intracellular membrane trafficking in C. elegans.
Development 2013 140(7) 1560-72 
[ PubMed ID = 23482491 ] [ RRC reference ]