Home > Mutants (Isolated) > tm5421

Mutants (Isolated)

Allele Name		tm5421
Sequence Name		C48E7.11
CGC Name		C48E7.11
Worm Base	Allele Name	tm5421
	CGC Name	C48E7.11
	Sequence	C48E7.11
Phenotype		Let or Ste.
Mutation site		18507/18508-TTCCACTAAACGAAAACGGAATA-18860/18861 (353 bp deletion + 23 bp insertion)
Chromosome		I
Putative gene structure		join(18420..18517, 18563..18650, 18698..18814)
Map position		0.89
Balancer		hT2
Map position of balancer
Sequence of primers		ExtFwd:GGTTATATGCTCTCTGTACC,IntFwd:GTGGTGTCTCACGCAACGAC,ExtRev:GGTACGCTGTCATTTCATAG,IntRev:CAGAAGACTAAGCCCCTGTA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Reddy KC, Dunbar TL, Nargund AM, Haynes CM, Troemel ER. The C. elegans CCAAT-Enhancer-Binding Protein Gamma Is Required for Surveillance Immunity. Cell Rep 2016 14(7) 1581-1589  [ PubMed ID = 26876169 ] [ RRC reference ] Tjahjono E, Kirienko NV. A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa. PLoS Genet 2017 13(6) e1006876  [ PubMed ID = 28662060 ] [ RRC reference ]