Home > Mutants (Isolated) > tm5414

Mutants (Isolated)

Allele Name		tm5414
Allele Type		Normal
Sequence Name		C35C5.11
Gene Name		C35C5.11
Worm Base	Allele Name	tm5414
	Gene Name	C35C5.11
	Sequence	C35C5.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		13527/13528-13873/13874 (346 bp deletion)
Chromosome		X
Putative gene structure		join(13676..13805, 13911..14338, 14386..14620, 14750..14860, 14909..14996, 15047..15228, 15333..15513, 15562..15633, 15719..15815, 15864..15983, 16028..16101, 16148..16273, 16341..16599)
Map position		4.35
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CAACGGAAGTTTGATGCCTG,IntRev:GTGCCTCTTTGAACGGCATG,ExtRev:GAAGGGAATGCCGGCAATCT,IntFwd:GCATGTCGAACACATCTAAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Panska L, Nedvedova S, Vacek V, Krivska D, Konecny L, Knop F, Kutil Z, Skultetyova L, Leontovyc A, Ulrychova L, Sakanari J, Asahina M, Barinka C, Macurkova M, Dvorak J. Uncovering the essential roles of glutamate carboxypeptidase 2 orthologs in Caenorhabditis elegans. Biosci Rep 2024 44(1)   [ PubMed ID = 38108122 ] [ RRC reference ]