Mutants (Isolated)

tm5409

Allele Nametm5409
Sequence NameF46B6.3
CGC Namesmg-4
Worm BaseAllele Name tm5409
CGC Name smg-4
Sequence F46B6.3
Phenotypehomozygous viable.
Mutation site7939/7940-CAAGTTTCCGAATTTGCGTCCTGCTTCTCCCC-8277/8278 (338 bp deletion + 32 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(7222..7353, 7692..8200, 8253..8578, 8632..8771))
Map position2.2
Balancer
Map position of balancer
Sequence of primersIntFwd:GCCGTGTATCGGTTTCCTTA,ExtFwd:TAGAAGATGGTGCCGTTCGT,IntRev:GACCGATTCAAAAGACGGTC,ExtRev:TCCGGTCTGCACCCGTTAAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sakaki K, Yoshina S, Shen X, Han J, DeSantis MR, Xiong M, Mitani S, Kaufman RJ.
RNA surveillance is required for endoplasmic reticulum homeostasis.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(21) 8079-84 
[ PubMed ID = 22562797 ] [ RRC reference ]