Mutants (Isolated)

tm5409

Allele Nametm5409
Sequence NameF46B6.3
CGC Namesmg-4
Worm BaseAllele Name tm5409
CGC Name smg-4
Sequence F46B6.3
Phenotypehomozygous viable.
Mutation site7939/7940-CAAGTTTCCGAATTTGCGTCCTGCTTCTCCCC-8277/8278 (338 bp deletion + 32 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(7222..7353, 7692..8200, 8253..8578, 8632..8771))
Map position2.2
Balancer
Map position of balancer
Sequence of primersIntFwd:GCCGTGTATCGGTTTCCTTA,ExtFwd:TAGAAGATGGTGCCGTTCGT,IntRev:GACCGATTCAAAAGACGGTC,ExtRev:TCCGGTCTGCACCCGTTAAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sakaki K, Yoshina S, Shen X, Han J, DeSantis MR, Xiong M, Mitani S, Kaufman RJ.
RNA surveillance is required for endoplasmic reticulum homeostasis.
Proc Natl Acad Sci U S A 2012 109(21) 8079-84 
[ PubMed ID = 22562797 ] [ RRC reference ]

McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH.
Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation.
Proc Natl Acad Sci U S A 2020 117(1) 656-667 
[ PubMed ID = 31754030 ] [ RRC reference ]