Mutants (Isolated)

tm5404

Allele Nametm5404
Sequence NameF56F4.6
CGC Nameabt-6
Worm BaseAllele Name tm5404
CGC Name abt-6
Sequence F56F4.6
Phenotypehomozygous viable.
Mutation site6692/6693-7034/7035 (342 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(6020..6086, 6271..6314, 6359..6767, 6960..7030, 7081..7248))
Map position0.79
Balancer
Map position of balancer
Sequence of primersExtFwd:GAACGTATCCTCAAGTGATG,ExtRev:TGCCGTGATACCCAGAATCT,IntFwd:GCTTGGGTCAACATGTAGTC,IntRev:CAGAGGCCTGGTTAAGTCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]