Mutants (Isolated)

tm539

Allele Nametm539
Sequence NameF10E7.2
CGC NameF10E7.2
Worm BaseAllele Name tm539
CGC Name F10E7.2
Sequence F10E7.2
Phenotypehomozygous viable
Mutation site22469/22470-23161/23162 (692 bp deletion)
ChromosomeII
Putative gene structurejoin(21609..21661, 21709..21796, 23024..23149, 23277..23753)
Map position0.5
Balancer
Map position of balancer
Sequence of primersExtFwd:AGCTACTTGGCTCATGGCCT,ExtRev:CAAGGCAAATGAATCTGGGT,IntFwd:GCCTCGAAAACGGAAAATTC,IntRev:CAGGGCGTTCTTCCATCCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Vergara IA, Tarailo-Graovac M, Frech C, Wang J, Qin Z, Zhang T, She R, Chu JS, Wang K, Chen N.
Genome-wide variations in a natural isolate of the nematode Caenorhabditis elegans.
BMC Genomics 2014 15 255 
[ PubMed ID = 24694239 ] [ RRC reference ]