Mutants (Isolated)

tm5375

Allele Nametm5375
Sequence NameZK512.5
CGC Namesec-16
Worm BaseAllele Name tm5375
CGC Name sec-16
Sequence ZK512.5
Phenotypelethal or sterile
Mutation site14858/14859-15198/15199 (340 bp deletion)
ChromosomeIII
Putative gene structurejoin(13445..13459, 13833..13872, 13927..14026, 14086..14253, 14299..14893, 14940..15052, 15098..15536, 15586..15741, 15787..16062, 16109..16314, 16362..17433, 17489..17638, 17691..17976, 18026..18108)
Map position0.17
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:CGCCGTGTTGGCACTAAAGT,ExtRev:AACCAGACTCGGATGTCCCA,IntFwd:GACCTCAATTTGCCCCTTCT,IntRev:CGAGGCATTTGTCAGCAGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ihara S, Nakayama S, Murakami Y, Suzuki E, Asakawa M, Kinoshita T, Sawa H.
PIGN prevents protein aggregation in the endoplasmic reticulum independently of its function in the GPI synthesis.
J Cell Sci 2017 130(3) 602-613 
[ PubMed ID = 27980068 ] [ RRC reference ]