Mutants (Isolated)

tm5332

Allele Nametm5332
Allele TypeNormal
Sequence NameY71F9AL.4
Gene NameY71F9AL.4
Worm BaseAllele Name tm5332
Gene Name Y71F9AL.4
Sequence Y71F9AL.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 45453/45454-46006/46007 (553 bp deletion)
ChromosomeI
Putative gene structurejoin(43675..43690, 43820..43926, 43979..44107, 45014..45208, 45261..45368, 45446..45738, 46058..46118, 46166..46344, 46408..46561, 47318..47749)
Map position-5.34
Balancer
Map position of balancer
Sequence of primersIntFwd:CGAGATATTTGCACGCCAGA,ExtRev:AGTTTGGATTCCTGGCCGGT,ExtFwd:GCGCGAAAATGTCGACAGAG,IntRev:CCTCAGTGCAATATTCGGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Franziscus CA, Ritz D, Kappel NC, Solinger JA, Schmidt A, Spang A.
The protein tyrosine phosphatase PPH-7 is required for fertility and embryonic development in C. elegans at elevated temperatures.
FEBS Open Bio 2024 14(3) 390-409 
[ PubMed ID = 38320757 ] [ RRC reference ]