Mutants (Isolated)

tm533

Allele Nametm533
Allele TypeNormal
Sequence NameF25B5.1
Gene Namedct-6
Worm BaseAllele Name tm533
Gene Name dct-6
Sequence F25B5.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31236/31237-C-31901/31902 (665 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurejoin(30213..30265, 30404..30492, 30538..30824, 30874..30971, 31181..31526, 31922..32424, 32583..32705, 33040..33127, 33377..33722, 33990..34240, 34311..34599, 34645..34760, 34944..35114)
Map position-1.43
Balancer
Map position of balancer
Sequence of primersIntRev:TTGCACAGGCCGCAGTGAGA,ExtRev:ACACCTTCAGCGGATTTCAT,ExtFwd:GAGGCGCACTTTTTAGGCAT,IntFwd:AGATGATGGGAGGCTTCTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Franziscus CA, Ritz D, Kappel NC, Solinger JA, Schmidt A, Spang A.
The protein tyrosine phosphatase PPH-7 is required for fertility and embryonic development in C. elegans at elevated temperatures.
FEBS Open Bio 2024 14(3) 390-409 
[ PubMed ID = 38320757 ] [ RRC reference ]