Mutants (Isolated)

tm5268

Allele Nametm5268
Sequence NameC28H8.1
CGC Namebcl-7
Worm BaseAllele Name tm5268
CGC Name bcl-7
Sequence C28H8.1
PhenotypeLet or Ste.
Mutation site43217/43218-43948/43949 (731 bp deletion)
ChromosomeIII
Putative gene structurejoin(43388..43453, 43501..43591, 43814..44097)
Map position-1.43
BalancerhT2
Map position of balancer
Sequence of primersIntRev:AGTGGCTCCACCTTGATAGT,ExtRev:TGTCATTTCAGCGTCGCGCA,IntFwd:GCTCCGTCAGACTCGTAGAT,ExtFwd:TCCGGATGAGTTGGATTGTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Uehara T, Kage-Nakadai E, Yoshina S, Imae R, Mitani S.
The Tumor Suppressor BCL7B Functions in the Wnt Signaling Pathway.
PLoS Genet. 2015 11(1) e1004921 
[ PubMed ID = 25569233 ] [ RRC reference ]