Mutants (Isolated)

tm5255

Allele Nametm5255
Sequence NameC01B12.4
CGC NameC01B12.4
Worm BaseAllele Name tm5255
CGC Name C01B12.4
Sequence C01B12.4
Phenotypehomozygous viable.
Mutation site3391/3392-3816/3817 (425 bp deletion)
ChromosomeII
Putative gene structurejoin(2246..2327, 2961..3115, 3163..3236, 3292..3453, 3499..3612, 3854..4092, 4487..4815)
Map position-18.02
Balancer
Map position of balancer
Sequence of primersExtFwd:TACGGTATGTAGATGCCTAG,ExtRev:CAATGCCTTCGCAGCAGCTG,IntFwd:GCCTAGAACGCTAAGGTTGT,IntRev:GATCCGAAGTGATCAAGCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Olivier-Mason A, Wojtyniak M, Bowie RV, Nechipurenko IV, Blacque OE, Sengupta P.
Transmembrane protein OSTA-1 shapes sensory cilia morphology via regulation of intracellular membrane trafficking in C. elegans.
Development 2013 140(7) 1560-72 
[ PubMed ID = 23482491 ] [ RRC reference ]