Mutants (Isolated)

tm5234

Allele Nametm5234
Sequence NameT03F1.1
CGC NameT03F1.1
Worm BaseAllele Name tm5234
CGC Name T03F1.1
Sequence T03F1.1
Phenotypehomozygous viable.
Mutation site36895/36896-37301/37302 (406 bp deletion)
ChromosomeI
Putative gene structurejoin(36519..36958, 37007..37280, 37330..37875)
Map position-1.95
Balancer
Map position of balancer
Sequence of primersIntRev:CTGGGCATCTCTCTTGATTG,ExtRev:AGCCGGCGACAATTCAGTCT,IntFwd:CGTGTTCTTCCCACTATCTG,ExtFwd:GACATGCTTTTCGATCGGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen C, Itakura E, Weber KP, Hegde RS, de Bono M.
An ER complex of ODR-4 and ODR-8/Ufm1 specific protease 2 promotes GPCR maturation by a Ufm1-independent mechanism.
PLoS Genet 2014 10(3) e1004082 
[ PubMed ID = 24603482 ] [ RRC reference ]