Mutants (Isolated)

tm5232

Allele Nametm5232
Sequence NameD2013.3
CGC NameD2013.3
Worm BaseAllele Name tm5232
CGC Name D2013.3
Sequence D2013.3
Phenotypehomozygous viable.
Mutation site18696/18697-18908/18909 (212 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(18080..18157, 18209..18509, 18565..18756, 18985..19218, 19263..19349, 19394..19540, 19821..19864))
Map position1.14
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGTTGATCTGTCAAGGGAT,IntFwd:GTATCCTACCTCATAGCTTG,IntRev:GTCAGAAAACCAGACGGGTC,ExtRev:GTTCGTCACGAGGAGTACAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Babu V, Hofmann K, Schumacher B.
A C. elegans homolog of the Cockayne syndrome complementation group A gene.
DNA Repair (Amst) 2014 24 57-62 
[ PubMed ID = 25453470 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]