Mutants (Isolated)

tm5221

Allele Nametm5221
Sequence NameZK1236.7
CGC Nameufbp-1
Worm BaseAllele Name tm5221
CGC Name ufbp-1
Sequence ZK1236.7
Phenotypehomozygous viable.
Mutation site[C30C11] 1196/1197-[C30C11] 1388/1389 (192 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(26832..26932, 27017..27275, 27845..28221, 30428..30555, 30602..30711))
Map position-0.26
Balancer
Map position of balancer
Sequence of primersIntRev:GCCCTCCCAATTCGTCATGT,IntFwd:CCAGCAACATATCGGTCCTC,ExtRev:GCGTCTTCCTCGCATACTAG,ExtFwd:GCACCTTCATTCATTGCCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Colin E, Daniel J, Ziegler A, Wakim J, Scrivo A, Haack TB, Khiati S, Denommé AS, Amati-Bonneau P, Charif M, Procaccio V, Reynier P, Aleck KA, Botto LD, Herper CL, Kaiser CS, Nabbout R, N'Guyen S, Mora-Lorca JA, Assmann B, Christ S, Meitinger T, Strom TM, Prokisch H, FREX Consortium, Miranda-Vizuete A, Hoffmann GF, Lenaers G, Bomont P, Liebau E, Bonneau D.
Biallelic Variants in UBA5 Reveal that Disruption of the UFM1 Cascade Can Result in Early-Onset Encephalopathy.
Am J Hum Genet 2016 99(3) 695-703 
[ PubMed ID = 27545681 ] [ RRC reference ]