Home > Mutants (Isolated) > tm5221

Mutants (Isolated)

Allele Name		tm5221
Allele Type		Normal
Sequence Name		ZK1236.7
Gene Name		ufbp-1
Worm Base	Allele Name	tm5221
	Gene Name	ufbp-1
	Sequence	ZK1236.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		[C30C11] 1196/1197-[C30C11] 1388/1389 (192 bp deletion)
Chromosome		III
Putative gene structure		complement(join(26832..26932, 27017..27275, 27845..28221, 30428..30555, 30602..30711))
Map position		-0.26
Balancer
Map position of balancer
Sequence of primers		IntRev:GCCCTCCCAATTCGTCATGT,IntFwd:CCAGCAACATATCGGTCCTC,ExtRev:GCGTCTTCCTCGCATACTAG,ExtFwd:GCACCTTCATTCATTGCCAG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Colin E, Daniel J, Ziegler A, Wakim J, Scrivo A, Haack TB, Khiati S, Denommé AS, Amati-Bonneau P, Charif M, Procaccio V, Reynier P, Aleck KA, Botto LD, Herper CL, Kaiser CS, Nabbout R, N'Guyen S, Mora-Lorca JA, Assmann B, Christ S, Meitinger T, Strom TM, Prokisch H, FREX Consortium, Miranda-Vizuete A, Hoffmann GF, Lenaers G, Bomont P, Liebau E, Bonneau D. Biallelic Variants in UBA5 Reveal that Disruption of the UFM1 Cascade Can Result in Early-Onset Encephalopathy. Am J Hum Genet 2016 99(3) 695-703  [ PubMed ID = 27545681 ] [ RRC reference ]