Allele Name | tm5213 |
Allele Type | Normal |
Sequence Name | T24F1.4 |
Gene Name | T24F1.4 |
Worm Base | Allele Name |
tm5213
|
Gene Name |
T24F1.4
|
Sequence |
T24F1.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 12245/12246-12546/12547 (301 bp deletion) |
Chromosome | II |
Putative gene structure | complement(join(12202..12283, 12342..12492, 12617..12748, 12889..12973)) |
Map position | 3.41 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GAGTATGGAGGCGGCTGATC,IntFwd:GCGGCTGATCCTTAGCGATA,ExtRev:AGACTGCCCTCCACACTGGA,IntRev:CCGCATGTGACTGGCCAATT |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Chisnell P, Parenteau TR, Tank E, Ashrafi K, Kenyon C. The mTOR Target S6 Kinase Arrests Development in Caenorhabditis elegans When the Heat-Shock Transcription Factor Is Impaired. Genetics 2018 210(3) 999-1009
[ PubMed ID = 30228197 ]
[ RRC reference ]
|
Smith CJ, O'Brien T, Chatzigeorgiou M, Spencer WC, Feingold-Link E, Husson SJ, Hori S, Mitani S, Gottschalk A, Schafer WR, Miller DM 3rd. Sensory neuron fates are distinguished by a transcriptional switch that regulates dendrite branch stabilization. Neuron 2013 79(2) 266-80
[ PubMed ID = 23889932 ]
[ RRC reference ]
|
|