Home > Mutants (Isolated) > tm5213

Mutants (Isolated)

Allele Name		tm5213
Allele Type		Normal
Sequence Name		T24F1.4
Gene Name		T24F1.4
Worm Base	Allele Name	tm5213
	Gene Name	T24F1.4
	Sequence	T24F1.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		12245/12246-12546/12547 (301 bp deletion)
Chromosome		II
Putative gene structure		complement(join(12202..12283, 12342..12492, 12617..12748, 12889..12973))
Map position		3.41
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GAGTATGGAGGCGGCTGATC,IntFwd:GCGGCTGATCCTTAGCGATA,ExtRev:AGACTGCCCTCCACACTGGA,IntRev:CCGCATGTGACTGGCCAATT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Chisnell P, Parenteau TR, Tank E, Ashrafi K, Kenyon C. The mTOR Target S6 Kinase Arrests Development in Caenorhabditis elegans When the Heat-Shock Transcription Factor Is Impaired. Genetics 2018 210(3) 999-1009  [ PubMed ID = 30228197 ] [ RRC reference ] Smith CJ, O'Brien T, Chatzigeorgiou M, Spencer WC, Feingold-Link E, Husson SJ, Hori S, Mitani S, Gottschalk A, Schafer WR, Miller DM 3rd. Sensory neuron fates are distinguished by a transcriptional switch that regulates dendrite branch stabilization. Neuron 2013 79(2) 266-80  [ PubMed ID = 23889932 ] [ RRC reference ]