Home > Mutants (Isolated) > tm5210

Mutants (Isolated)

Allele Name		tm5210
Allele Type		Balanced
Sequence Name		F52C9.1
Gene Name		F52C9.1
Worm Base	Allele Name	tm5210
	Gene Name	F52C9.1
	Sequence	F52C9.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		26089/26090-CA-27278/27279 (1189 bp deletion + 2 bp insertion)
Chromosome		III
Putative gene structure		join(24821..24996, 25411..26136, 26408..26625, 26715..26863, 26964..27137, 27189..27269, 27487..27624, 27671..28004, 28049..28551, 28718..29068, 29289..29447, 29718..30067, 30124..30246, 30292..30653, 30777..30883, 31370..31539, 31586..31733)
Map position		-1.83
Balancer		hT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primers		ExtFwd:ATCCCGCTCCACTGAACTAA,IntFwd:TCAACACCTCATTCGACCCT,ExtRev:CGCAAGAGATGATCGTGATC,IntRev:GAACGGATCGGATCATGTAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Liu X, Yin L, Li T, Lin L, Zhang J, Li Y. Reduction of WDR81 impairs autophagic clearance of aggregated proteins and cell viability in neurodegenerative phenotypes. PLoS Genet 2021 17(3) e1009415  [ PubMed ID = 33730050 ] [ RRC reference ] Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C. Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion. J Cell Biol 2016 212(2) 181-98  [ PubMed ID = 26783301 ] [ RRC reference ]