Mutants (Isolated)

tm5210

Allele Nametm5210
Sequence NameF52C9.1
CGC NameF52C9.1
Worm BaseAllele Name tm5210
CGC Name F52C9.1
Sequence F52C9.1
Phenotypelethal or sterile
Mutation site26089/26090-CA-27278/27279 (1189 bp deletion + 2 bp insertion)
ChromosomeIII
Putative gene structurejoin(24821..24996, 25411..26136, 26408..26625, 26715..26863, 26964..27137, 27189..27269, 27487..27624, 27671..28004, 28049..28551, 28718..29068, 29289..29447, 29718..30067, 30124..30246, 30292..30653, 30777..30883, 31370..31539, 31586..31733)
Map position-1.83
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:ATCCCGCTCCACTGAACTAA,IntFwd:TCAACACCTCATTCGACCCT,ExtRev:CGCAAGAGATGATCGTGATC,IntRev:GAACGGATCGGATCATGTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]