Mutants (Isolated)

tm5205

Allele Nametm5205
Sequence NameY53G8AR.3
CGC Nameral-1
Worm BaseAllele Name tm5205
CGC Name ral-1
Sequence Y53G8AR.3
Phenotypelethal or sterile
Mutation site31091/30192-31594/31595 (503 bp deletion)
ChromosomeIII
Putative gene structurejoin(31144..31200, 31276..31341, 32350..32471, 32777..32863, 34473..34650, 35947..36078)
Map position-7.29
BalancerqC1 [qIs26]
Map position of balancer
Sequence of primersExtRev:CCGAAACTCGTTTGTAGCCT,IntRev:CCCTCACCACTTCGATAGTA,IntFwd:GTACCCCTCAACTGTCGTAA,ExtFwd:GCTTTCTACCGTACCCCTCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Abrams J, Nance J.
A polarity pathway for exocyst-dependent intracellular tube extension.
Elife 2021 10  
[ PubMed ID = 33687331 ] [ RRC reference ]

Shin H, Braendle C, Monahan KB, Kaplan REW, Zand TP, Mote FS, Peters EC, Reiner DJ.
Developmental fidelity is imposed by genetically separable RalGEF activities that mediate opposing signals.
PLoS Genet 2019 15(5) e1008056 
[ PubMed ID = 31086367 ] [ RRC reference ]

Reiner DJ, Lundquist EA.
Small GTPases.
WormBook 2018 2018 1-65 
[ PubMed ID = 27218782 ] [ RRC reference ]

Armenti ST, Chan E, Nance J.
Polarized exocyst-mediated vesicle fusion directs intracellular lumenogenesis within the C. elegans excretory cell.
Dev Biol 2014 394(1) 110-21 
[ PubMed ID = 25102190 ] [ RRC reference ]

Hyenne V, Apaydin A, Rodriguez D, Spiegelhalter C, Hoff-Yoessle S, Diem M, Tak S, Lefebvre O, Schwab Y, Goetz JG, Labouesse M.
RAL-1 controls multivesicular body biogenesis and exosome secretion.
J Cell Biol 2015 211(1) 27-37 
[ PubMed ID = 26459596 ] [ RRC reference ]