Home > Mutants (Isolated) > tm5205

Mutants (Isolated)

Allele Name		tm5205
Sequence Name		Y53G8AR.3
CGC Name		ral-1
Worm Base	Allele Name	tm5205
	CGC Name	ral-1
	Sequence	Y53G8AR.3
Phenotype		lethal or sterile
Mutation site		31091/30192-31594/31595 (503 bp deletion)
Chromosome		III
Putative gene structure		join(31144..31200, 31276..31341, 32350..32471, 32777..32863, 34473..34650, 35947..36078)
Map position		-7.29
Balancer		qC1 [qIs26]
Map position of balancer
Sequence of primers		ExtRev:CCGAAACTCGTTTGTAGCCT,IntRev:CCCTCACCACTTCGATAGTA,IntFwd:GTACCCCTCAACTGTCGTAA,ExtFwd:GCTTTCTACCGTACCCCTCA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Abrams J, Nance J. A polarity pathway for exocyst-dependent intracellular tube extension. Elife 2021 10   [ PubMed ID = 33687331 ] [ RRC reference ] Shin H, Braendle C, Monahan KB, Kaplan REW, Zand TP, Mote FS, Peters EC, Reiner DJ. Developmental fidelity is imposed by genetically separable RalGEF activities that mediate opposing signals. PLoS Genet 2019 15(5) e1008056  [ PubMed ID = 31086367 ] [ RRC reference ] Reiner DJ, Lundquist EA. Small GTPases. WormBook 2018 2018 1-65  [ PubMed ID = 27218782 ] [ RRC reference ] Armenti ST, Chan E, Nance J. Polarized exocyst-mediated vesicle fusion directs intracellular lumenogenesis within the C. elegans excretory cell. Dev Biol 2014 394(1) 110-21  [ PubMed ID = 25102190 ] [ RRC reference ] Hyenne V, Apaydin A, Rodriguez D, Spiegelhalter C, Hoff-Yoessle S, Diem M, Tak S, Lefebvre O, Schwab Y, Goetz JG, Labouesse M. RAL-1 controls multivesicular body biogenesis and exosome secretion. J Cell Biol 2015 211(1) 27-37  [ PubMed ID = 26459596 ] [ RRC reference ]