Mutants (Isolated)

tm5167

Allele Nametm5167
Sequence NameY110A7A.2
CGC NameY110A7A.2
Worm BaseAllele Name tm5167
CGC Name Y110A7A.2
Sequence Y110A7A.2
Phenotypehomozygous viable.
Mutation site53844/53845-AGA-54283/54284 (439 bp deletion + 3 bp insertion)
ChromosomeI
Putative gene structurejoin(53894..54050, 54313..54484, 55024..55319, 56255..56377, 56850..56941, 57665..57832)
Map position-0.34
Balancer
Map position of balancer
Sequence of primersIntRev:CAAGCTCAATGGCCTATCCT,ExtRev:CATTAGGCCGGAATTCTCTA,IntFwd:TAGCCTGGTTCTTCCCTTTC,ExtFwd:CTAGGTAGTACTCTCTCTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang J, Kaletsky R, Silva M, Williams A, Haas LA, Androwski RJ, Landis JN, Patrick C, Rashid A, Santiago-Martinez D, Gravato-Nobre M, Hodgkin J, Hall DH, Murphy CT, Barr MM.
Cell-Specific Transcriptional Profiling of Ciliated Sensory Neurons Reveals Regulators of Behavior and Extracellular Vesicle Biogenesis.
Curr Biol 2015 25(24) 3232-8 
[ PubMed ID = 26687621 ] [ RRC reference ]

Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M.
IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses.
Nature 2017 542(7639) 43-48 
[ PubMed ID = 28099418 ] [ RRC reference ]