Mutants (Isolated)

tm5159

Allele Nametm5159
Sequence NameT01G9.3
CGC NameT01G9.3
Worm BaseAllele Name tm5159
CGC Name T01G9.3
Sequence T01G9.3
Phenotypehomozygous viable.
Mutation site9239/9240-9911/9912 (672 bp deletion)
ChromosomeI
Putative gene structurejoin(9024..9227, 9304..10135, 10288..10472, 10570..10698, 10748..10855, 10903..11256)
Map position2.7
Balancer
Map position of balancer
Sequence of primersExtRev:GTGGTTGTAGGCCAGTTCGA,IntRev:ATAGGTCCATGACTCCTCGA,ExtFwd:CTCATGGTGTTTTGCCTCAC,IntFwd:ACTACCATCATCATGTCCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tang LT, Diaz-Balzac CA, Rahman M, Ramirez-Suarez NJ, Salzberg Y, Lázaro-Peña MI, Bülow HE.
TIAM-1/GEF can shape somatosensory dendrites independently of its GEF activity by regulating F-actin localization.
Elife 2019 8  
[ PubMed ID = 30694177 ] [ RRC reference ]

Salzberg Y, Coleman AJ, Celestrin K, Cohen-Berkman M, Biederer T, Henis-Korenblit S, Bülow HE.
Reduced Insulin/Insulin-Like Growth Factor Receptor Signaling Mitigates Defective Dendrite Morphogenesis in Mutants of the ER Stress Sensor IRE-1.
PLoS Genet 2017 13(1) e1006579 
[ PubMed ID = 28114319 ] [ RRC reference ]

Díaz-Balzac CA, Rahman M, Lázaro-Peña MI, Martin Hernandez LA, Salzberg Y, Aguirre-Chen C, Kaprielian Z, Bülow HE.
Muscle- and Skin-Derived Cues Jointly Orchestrate Patterning of Somatosensory Dendrites.
Curr Biol 2016 26(17) 2379-87 
[ PubMed ID = 27451901 ] [ RRC reference ]

Richardson CE, Yee C, Shen K.
A hormone receptor pathway cell-autonomously delays neuron morphological aging by suppressing endocytosis.
PLoS Biol 2019 17(10) e3000452 
[ PubMed ID = 31589601 ] [ RRC reference ]

Salzberg Y, Ramirez-Suarez NJ, Bülow HE.
The proprotein convertase KPC-1/furin controls branching and self-avoidance of sensory dendrites in Caenorhabditis elegans.
PLoS Genet 2014 10(9) e1004657 
[ PubMed ID = 25232734 ] [ RRC reference ]

Salzberg Y, Díaz-Balzac CA, Ramirez-Suarez NJ, Attreed M, Tecle E, Desbois M, Kaprielian Z, Bülow HE.
Skin-derived cues control arborization of sensory dendrites in Caenorhabditis elegans.
Cell 2013 155(2) 308-20 
[ PubMed ID = 24120132 ] [ RRC reference ]

Zou W, Yadav S, DeVault L, Nung Jan Y, Sherwood DR.
RAB-10-Dependent Membrane Transport Is Required for Dendrite Arborization.
PLoS Genet 2015 11(9) e1005484 
[ PubMed ID = 26394140 ] [ RRC reference ]