Mutants (Isolated)

tm515

Allele Nametm515
Sequence NameC37H5.8
CGC Namehsp-6
Worm BaseAllele Name tm515
CGC Name hsp-6
Sequence C37H5.8
Phenotypelethal or sterile
Mutation site6425/6426-6829/6830 (404 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(5510..5913, 5976..6892, 6941..7249, 7317..7660))
Map position-6.52
Balancerunc-62(e644) V,nT1 [qIs51]
Map position of balancer-5.18
Sequence of primersIntRev:TTGTCTTCCGCTCGCACAAT,ExtRev:GCTTTCCGCACGATCATTCT,ExtFwd:TTTGGCTCCTCGGCGGTCTT,IntFwd:GCGTCACCTCCAGAGTTCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8 
[ PubMed ID = 22972192 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]