Mutants (Isolated)

tm5124

Allele Nametm5124
Sequence NameT22H6.1
CGC NameT22H6.1
Worm BaseAllele Name tm5124
CGC Name T22H6.1
Sequence T22H6.1
Phenotypehomozygous viable.
Mutation site3387/3388-3782/3783 (395 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(3057..3191, 3237..3338, 3391..3534, 4186..4369, 4498..4553))
Map position8.39
Balancer
Map position of balancer
Sequence of primersExtFwd:AGATCTGACCACGAGGTCTT,IntFwd:ATCTCCATCCGCATTCGCAT,ExtRev:ATCACATTGAGGGTGGTAGA,IntRev:TTCCTACCGATGAGTACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M.
IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses.
Nature 2017 542(7639) 43-48 
[ PubMed ID = 28099418 ] [ RRC reference ]