Mutants (Isolated)

tm512

Allele Nametm512
Sequence NameY73F8A.16
CGC Nametbx-39
Worm BaseAllele Name tm512
CGC Name tbx-39
Sequence Y73F8A.16
Phenotypehomozygous viable. Dr. J.K. Liu: no defects in the M lineage. Dr. M. Maduro: normal early embryogenesis at 4-30 cell stage.
Mutation site98632/98633-NGGATTCCNNT-99088/99089 (456 bp deletion + 11 bp insertion)
ChromosomeIV
Putative gene structurejoin(97556..97752, 97805..97991, 98046..98852)
Map position13.47
Balancer
Map position of balancer
Sequence of primersIntRev:AAAGTTACGTATCTGCGGCC,ExtRev:ATCAACGACAGGAAAAGTCG,IntFwd:GTGTTTTGCAGAGCGGAGTA,ExtFwd:CTAACATCAATAAGGCCACC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kinchen JM, Doukoumetzidis K, Almendinger J, Stergiou L, Tosello-Trampont A, Sifri CD, Hengartner MO, Ravichandran KS.
A pathway for phagosome maturation during engulfment of apoptotic cells.
Nat. Cell Biol. 2008 10(5) 556-66 
[ PubMed ID = 18425118 ] [ RRC reference ]