Mutants (Isolated)

tm5089

Allele Nametm5089
Sequence NameF59A3.9
CGC Namepup-3
Worm BaseAllele Name tm5089
CGC Name pup-3
Sequence F59A3.9
Phenotypehomozygous viable.
Mutation site32252/32253-TA-32540/32541 (288 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(30080..30617, 31205..31397, 31450..31578, 31733..31841, 32212..32396, 32444..32543, 32835..33029))
Map position0.1
Balancer
Map position of balancer
Sequence of primersIntRev:CAACCTTGTCATTGCTCTAC,ExtRev:GAATAGAGCGTCTTACGTAC,IntFwd:TCTACACTTTTGTGCGGGAG,ExtFwd:CGGTTAGAACTGGGTTGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li Y, Maine EM.
The balance of poly(U) polymerase activity ensures germline identity, survival and development in Caenorhabditis elegans.
Development 2018 145(19)  
[ PubMed ID = 30305273 ] [ RRC reference ]

Wang Y, Weng C, Chen X, Zhou X, Huang X, Yan Y, Zhu C.
CDE-1 suppresses the production of risiRNA by coupling polyuridylation and degradation of rRNA.
BMC Biol 2020 18(1) 115 
[ PubMed ID = 32887607 ] [ RRC reference ]