Home > Mutants (Isolated) > tm5089

Mutants (Isolated)

Allele Name		tm5089
Allele Type		Normal
Sequence Name		F59A3.9
Gene Name		pup-3
Worm Base	Allele Name	tm5089
	Gene Name	pup-3
	Sequence	F59A3.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		32252/32253-TA-32540/32541 (288 bp deletion + 2 bp insertion)
Chromosome		I
Putative gene structure		complement(join(30080..30617, 31205..31397, 31450..31578, 31733..31841, 32212..32396, 32444..32543, 32835..33029))
Map position		0.1
Balancer
Map position of balancer
Sequence of primers		IntRev:CAACCTTGTCATTGCTCTAC,ExtRev:GAATAGAGCGTCTTACGTAC,IntFwd:TCTACACTTTTGTGCGGGAG,ExtFwd:CGGTTAGAACTGGGTTGGTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Wang Y, Weng C, Chen X, Zhou X, Huang X, Yan Y, Zhu C. CDE-1 suppresses the production of risiRNA by coupling polyuridylation and degradation of rRNA. BMC Biol 2020 18(1) 115  [ PubMed ID = 32887607 ] [ RRC reference ] Li Y, Maine EM. The balance of poly(U) polymerase activity ensures germline identity, survival and development in Caenorhabditis elegans. Development 2018 145(19)   [ PubMed ID = 30305273 ] [ RRC reference ]