Mutants (Isolated)

tm5083

Allele Name

tm5083

Allele Type

Normal

Sequence Name

C44B11.3

Gene Name

mec-12

Worm Base

Allele Name

tm5083

Gene Name

mec-12

Sequence

C44B11.3

Phenotype

homozygous viable.

Mutation site

3012/3013-3245/3246 (233 bp deletion)

Chromosome

III

Putative gene structure

complement(join(139..435, 2097..2531, 3137..3531, 5933..6155, 7538..7540))

Map position

-7.88

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TAAAGGCGCGAAGGGCGAAC,IntFwd:CTGAGTGAGCTGATTACAGT,ExtRev:ATAGCCTTACTCGTTGCGGA,IntRev:GTGCTAGAGAGTGTGGGGTG

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A.
Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons.
PLoS Genet 2023 19(8) e1010885
[ PubMed ID = 37603562 ] [ RRC reference ]

Teoh JS, Vasudevan A, Wang W, Dhananjay S, Chandhok G, Pocock R, Koushika SP, Neumann B.
Synaptic branch stability is mediated by non-enzymatic functions of MEC-17/αTAT1 and ATAT-2.
Sci Rep 2022 12(1) 14003
[ PubMed ID = 35977998 ] [ RRC reference ]

Miyasaka T, Shinzaki Y, Yoshimura S, Yoshina S, Kage-Nakadai E, Mitani S, Ihara Y.
Imbalanced Expression of Tau and Tubulin Induces Neuronal Dysfunction in C. elegans Models of Tauopathy.
Front Neurosci 2018 12 415
[ PubMed ID = 29973863 ] [ RRC reference ]

Serrano-Saiz E, Oren-Suissa M, Bayer EA, Hobert O.
Sexually Dimorphic Differentiation of a C. elegans Hub Neuron Is Cell Autonomously Controlled by a Conserved Transcription Factor.
Curr Biol 2017 27(2) 199-209
[ PubMed ID = 28065609 ] [ RRC reference ]

Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M.
Distinct effects of tubulin isotype mutations on neurite growth in Caenorhabditis elegans.
Mol Biol Cell 2017 28(21) 2786-2801
[ PubMed ID = 28835377 ] [ RRC reference ]

Chen CH, Lee A, Liao CP, Liu YW, Pan CL.
RHGF-1/PDZ-RhoGEF and retrograde DLK-1 signaling drive neuronal remodeling on microtubule disassembly.
Proc Natl Acad Sci U S A 2014 111(46) 16568-73
[ PubMed ID = 25359212 ] [ RRC reference ]

Hsu JM, Chen CH, Chen YC, McDonald KL, Gurling M, Lee A, Garriga G, Pan CL.
Genetic analysis of a novel tubulin mutation that redirects synaptic vesicle targeting and causes neurite degeneration in C. elegans.
PLoS Genet 2014 10(11) e1004715
[ PubMed ID = 25392990 ] [ RRC reference ]