Mutants (Isolated)

tm5041

Allele Nametm5041
Sequence NameF39B2.7
CGC NameF39B2.7
Worm BaseAllele Name tm5041
CGC Name F39B2.7
Sequence F39B2.7
Phenotypehomozygous viable.
Mutation site19546/19547-TTTTTTTTTTTTT-20113/20114 (567 bp deletion + 13 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(15523..15685, 15732..16138, 17293..17575, 18626..18757, 19283..19550, 19750..19816))
Map position26.81
Balancer
Map position of balancer
Sequence of primersIntRev:CCTCTGTCGATTTACCCTGA,ExtRev:CATCACTACAGTACCTCTGT,IntFwd:CCTCGTGAATTCTCCTCGCT,ExtFwd:CCCTGGTTTGAACCCCGATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Navarro-González C, Moukadiri I, Villarroya M, López-Pascual E, Tuck S, Armengod ME.
Mutations in the Caenorhabditis elegans orthologs of human genes required for mitochondrial tRNA modification cause similar electron transport chain defects but different nuclear responses.
PLoS Genet 2017 13(7) e1006921 
[ PubMed ID = 28732077 ] [ RRC reference ]

Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]