| Allele Name | tm5041 |
| Sequence Name | F39B2.7 |
| CGC Name | F39B2.7 |
| Worm Base | Allele Name |
tm5041
|
| CGC Name |
F39B2.7
|
| Sequence |
F39B2.7
|
| Phenotype | homozygous viable. |
| Mutation site | 19546/19547-TTTTTTTTTTTTT-20113/20114 (567 bp deletion + 13 bp insertion) |
| Chromosome | I |
| Putative gene structure | complement(join(15523..15685, 15732..16138, 17293..17575, 18626..18757, 19283..19550, 19750..19816)) |
| Map position | 26.81 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CCTCTGTCGATTTACCCTGA,ExtRev:CATCACTACAGTACCTCTGT,IntFwd:CCTCGTGAATTCTCCTCGCT,ExtFwd:CCCTGGTTTGAACCCCGATT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Navarro-González C, Moukadiri I, Villarroya M, López-Pascual E, Tuck S, Armengod ME.
Mutations in the Caenorhabditis elegans orthologs of human genes required for mitochondrial tRNA modification cause similar electron transport chain defects but different nuclear responses.
PLoS Genet 2017 13(7) e1006921
[ PubMed ID = 28732077 ]
[ RRC reference ]
|
Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198
[ PubMed ID = 27306325 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.