Mutants (Isolated)

tm5040

Allele Nametm5040
Sequence NameT27F6.4
CGC NameT27F6.4
Worm BaseAllele Name tm5040
CGC Name T27F6.4
Sequence T27F6.4
Phenotypehomozygous viable.
Mutation site13777/13778-AAAATATAAAATATAT-14506/14507 (729 bp deletion + 16 bp insertion)
ChromosomeI
Putative gene structurejoin(14022..14204, 14852..15130, 15804..15962)
Map position13.23
Balancer
Map position of balancer
Sequence of primersIntFwd:CACGCTTTTGCCGTGGGAAT,ExtRev:AAGGGCTTGGGACTGCGAAA,IntRev:GGACTGCGAAAATCAGGCTT,ExtFwd:AGCGCACAGTTTCCCACGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shin H, Haupt KA, Kershner AM, Kroll-Conner P, Wickens M, Kimble J.
SYGL-1 and LST-1 link niche signaling to PUF RNA repression for stem cell maintenance in Caenorhabditis elegans.
PLoS Genet. 2017 13(12) e1007121 
[ PubMed ID = 29232700 ] [ RRC reference ]

Kershner AM, Shin H, Hansen TJ, Kimble J.
Discovery of two GLP-1/Notch target genes that account for the role of GLP-1/Notch signaling in stem cell maintenance.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(10) 3739-44 
[ PubMed ID = 24567412 ] [ RRC reference ]