Home > Mutants (Isolated) > tm5040

Mutants (Isolated)

Allele Name		tm5040
Allele Type		Normal
Sequence Name		T27F6.4
Gene Name		T27F6.4
Worm Base	Allele Name	tm5040
	Gene Name	T27F6.4
	Sequence	T27F6.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		13777/13778-AAAATATAAAATATAT-14506/14507 (729 bp deletion + 16 bp insertion)
Chromosome		I
Putative gene structure		join(14022..14204, 14852..15130, 15804..15962)
Map position		13.23
Balancer
Map position of balancer
Sequence of primers		IntFwd:CACGCTTTTGCCGTGGGAAT,ExtRev:AAGGGCTTGGGACTGCGAAA,IntRev:GGACTGCGAAAATCAGGCTT,ExtFwd:AGCGCACAGTTTCCCACGCT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Brenner JL, Schedl T. Germline Stem Cell Differentiation Entails Regional Control of Cell Fate Regulator GLD-1 in Caenorhabditis elegans. Genetics 2016 202(3) 1085-103  [ PubMed ID = 26757772 ] [ RRC reference ] Shin H, Haupt KA, Kershner AM, Kroll-Conner P, Wickens M, Kimble J. SYGL-1 and LST-1 link niche signaling to PUF RNA repression for stem cell maintenance in Caenorhabditis elegans. PLoS Genet 2017 13(12) e1007121  [ PubMed ID = 29232700 ] [ RRC reference ] Kershner AM, Shin H, Hansen TJ, Kimble J. Discovery of two GLP-1/Notch target genes that account for the role of GLP-1/Notch signaling in stem cell maintenance. Proc Natl Acad Sci U S A 2014 111(10) 3739-44  [ PubMed ID = 24567412 ] [ RRC reference ]