Allele Name | tm5040 |
Sequence Name | T27F6.4 |
CGC Name | T27F6.4 |
Worm Base | Allele Name |
tm5040
|
CGC Name |
T27F6.4
|
Sequence |
T27F6.4
|
Phenotype | homozygous viable. |
Mutation site | 13777/13778-AAAATATAAAATATAT-14506/14507 (729 bp deletion + 16 bp insertion) |
Chromosome | I |
Putative gene structure | join(14022..14204, 14852..15130, 15804..15962) |
Map position | 13.23 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:CACGCTTTTGCCGTGGGAAT,ExtRev:AAGGGCTTGGGACTGCGAAA,IntRev:GGACTGCGAAAATCAGGCTT,ExtFwd:AGCGCACAGTTTCCCACGCT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Brenner JL, Schedl T. Germline Stem Cell Differentiation Entails Regional Control of Cell Fate Regulator GLD-1 in Caenorhabditis elegans. Genetics 2016 202(3) 1085-103
[ PubMed ID = 26757772 ]
[ RRC reference ]
|
Shin H, Haupt KA, Kershner AM, Kroll-Conner P, Wickens M, Kimble J. SYGL-1 and LST-1 link niche signaling to PUF RNA repression for stem cell maintenance in Caenorhabditis elegans. PLoS Genet 2017 13(12) e1007121
[ PubMed ID = 29232700 ]
[ RRC reference ]
|
Kershner AM, Shin H, Hansen TJ, Kimble J. Discovery of two GLP-1/Notch target genes that account for the role of GLP-1/Notch signaling in stem cell maintenance. Proc Natl Acad Sci U S A 2014 111(10) 3739-44
[ PubMed ID = 24567412 ]
[ RRC reference ]
|
|