Mutants (Isolated)

tm5036

Allele Nametm5036
Sequence NameC23H5.7
CGC NameC23H5.7
Worm BaseAllele Name tm5036
CGC Name C23H5.7
Sequence C23H5.7
Phenotypehomozygous viable.
Mutation site14840/14841-15266/15267 (426 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(13106..13225, 13539..13634, 13686..13780, 14775..15216, 16364..16445, 16494..16805, 17346..17455, 17704..17924, 18768..18914, 19625..19833, 20246..20343, 20653..20655))
Map position-11.45
Balancer
Map position of balancer
Sequence of primersIntRev:CCGCGTCACGGTACTCTTGT,ExtRev:CTTAGTCGATATGGGGGTCA,IntFwd:ACGGCTTACACACCAAGCTT,ExtFwd:CGCGCGGCTCCTGTGATAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang H, Sieburth D.
PKA controls calcium influx into motor neurons during a rhythmic behavior.
PLoS Genet 2013 9(9) e1003831 
[ PubMed ID = 24086161 ] [ RRC reference ]

Smith HK, Luo L, O'Halloran D, Guo D, Huang XY, Samuel AD, Hobert O.
Defining specificity determinants of cGMP mediated gustatory sensory transduction in Caenorhabditis elegans.
Genetics 2013 194(4) 885-901 
[ PubMed ID = 23695300 ] [ RRC reference ]