Mutants (Isolated)

tm5027

Allele Nametm5027
Sequence NameY48G1BL.2
CGC Nameatm-1
Worm BaseAllele Name tm5027
CGC Name atm-1
Sequence Y48G1BL.2
Phenotypehomozygous viable.
Mutation site2422/2423-2935/2936 (513 bp deletion)
ChromosomeI
Putative gene structurejoin(269..590, 1494..1917, 2306..2450, 2532..2829, 3652..3823, 3925..4013, 4293..4543, 4936..5184)
Map position-19.16
Balancer
Map position of balancer
Sequence of primersIntFwd:CCGACGGCATCCTTGGTTTG,ExtFwd:CATCGGCGATACGTGAACAA,IntRev:GCCCCGTAATATTCGACAAT,ExtRev:GGCATACTCATGATCTCATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Jones MR, Huang JC, Chua SY, Baillie DL, Rose AM.
The atm-1 gene is required for genome stability in Caenorhabditis elegans.
Mol. Genet. Genomics 2012 287(4) 325-35 
[ PubMed ID = 22350747 ] [ RRC reference ]

Moriwaki T, Yamasaki A, Zhang-Akiyama QM.
ATM Induces Cell Death with Autophagy in Response to H2O2 Specifically in Caenorhabditis elegans Nondividing Cells.
Oxid Med Cell Longev 2018 2018 3862070 
[ PubMed ID = 30057676 ] [ RRC reference ]

Moriwaki T, Kato Y, Nakamura C, Ishikawa S, Zhang-Akiyama QM.
A novel DNA damage response mediated by DNA mismatch repair in Caenorhabditis elegans: induction of programmed autophagic cell death in non-dividing cells.
Genes Cancer 2015 6(7-8) 341-55 
[ PubMed ID = 26413217 ] [ RRC reference ]

Li X, O'Neil NJ, Moshgabadi N, Hieter P.
Synthetic cytotoxicity: digenic interactions with TEL1/ATM mutations reveal sensitivity to low doses of camptothecin.
Genetics 2014 197(2) 611-23 
[ PubMed ID = 24653001 ] [ RRC reference ]