Mutants (Isolated)

tm5012

Allele Nametm5012
Sequence NameF08H9.3
CGC NameF08H9.3
Worm BaseAllele Name tm5012
CGC Name F08H9.3
Sequence F08H9.3
Phenotypehomozygous viable.
Mutation site5834/5835-GTTCAATTATTTTTGTTTACAAACT-6499/6500 (665 bp deletion + 25 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(5924..6238, 6520..6648))
Map position6.41
Balancer
Map position of balancer
Sequence of primersIntFwd:CCAATGGCGATACTGTCGTG,ExtFwd:TAGGGGATGGGAACACGCGA,IntRev:GGGCTCTCTGGTAAATAATC,ExtRev:GATGCCTTGTCGCATGGGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]