Mutants (Isolated)

tm5011

Allele Nametm5011
Sequence NameB0218.1
CGC Namefaah-1
Worm BaseAllele Name tm5011
CGC Name faah-1
Sequence B0218.1
Phenotypehomozygous viable.
Mutation site13263/13264-TG-13778/13779 (515 bp deletion + 2 bp insertion)
ChromosomeIV
Putative gene structurejoin(12995..13069, 13270..13717, 14044..14399, 14451..14889, 15048..15236, 15303..15514)
Map position3.65
Balancer
Map position of balancer
Sequence of primersIntRev:CCGTCGTAGATTGTCTACGT,IntFwd:CGCACTTCCCTCAAACGAAT,ExtRev:CTAATCGTGCGTGCTCTCTC,ExtFwd:CCTCACAATCAGTACCATGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pastuhov SI, Fujiki K, Nix P, Kanao S, Bastiani M, Matsumoto K, Hisamoto N.
Endocannabinoid-Goα signalling inhibits axon regeneration in Caenorhabditis elegans by antagonizing Gqα-PKC-JNK signalling.
Nat Commun 2012 3 1136 
[ PubMed ID = 23072806 ] [ RRC reference ]

Pastuhov SI, Matsumoto K, Hisamoto N.
Endocannabinoid signaling regulates regenerative axon navigation in Caenorhabditis elegans via the GPCRs NPR-19 and NPR-32.
Genes Cells 2016 21(7) 696-705 
[ PubMed ID = 27193416 ] [ RRC reference ]

Harrison N, Lone MA, Kaul TK, Reis Rodrigues P, Ogungbe IV, Gill MS.
Characterization of N-acyl phosphatidylethanolamine-specific phospholipase-D isoforms in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(11) e113007 
[ PubMed ID = 25423491 ] [ RRC reference ]