Mutants (Isolated)

tm4967

Allele Nametm4967
Allele TypeBalanced
Sequence NameK12B6.2
Gene NameK12B6.2
Worm BaseAllele Name tm4967
Gene Name K12B6.2
Sequence K12B6.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3901/3902-4301/4302 (400 bp deletion)
ChromosomeV
Putative gene structurejoin(3854..3936, 3979..4162, 4207..4264, 4316..4495, 4545..4840, 4887..4982, 5182..5259, 5305..5538, 5582..5715, 5764..5868, 5916..6036, 6084..6218, 6261..6329, 6549..6953)
Map position-0.19
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:AACGTCTCCACGCGTAATTG,ExtFwd:ACCCGCACACTTTATCAGTC,IntRev:GGTAACAGCTCCCCGGCAAT,ExtRev:AGGCTCTCCAATGGTAACAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wilson LD, Obakpolor OA, Jones AM, Richie AL, Mieczkowski BD, Fall GT, Hall RW, Rumbley JN, Kroft TL.
The Caenorhabditis elegans spe-49 gene is required for fertilization and encodes a sperm-specific transmembrane protein homologous to SPE-42.
Mol Reprod Dev 2018 85(7) 563-578 
[ PubMed ID = 29693775 ] [ RRC reference ]