Mutants (Isolated)

tm4954

Allele Nametm4954
Sequence NameT05H10.1
CGC NameT05H10.1
Worm BaseAllele Name tm4954
CGC Name T05H10.1
Sequence T05H10.1
Phenotypehomozygous viable.
Mutation site755/756-1354/1355 (599 bp deletion)
ChromosomeII
Putative gene structurejoin(244..522, 569..1430, 1478..1758, 1803..2609, 2657..2980, 3090..3913, 3956..4265, 4309..4373, 4454..4682)
Map position0.66
Balancer
Map position of balancer
Sequence of primersExtFwd:CGACCCCAGTAATAGACAAT,IntFwd:TCGCTTTTTGGGATAGCGTG,ExtRev:GAGTCTTTCATCTTCCGCCT,IntRev:CGCCTCTCGTTCAAGTCTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
McCloskey RJ, Kemphues KJ.
Deubiquitylation machinery is required for embryonic polarity in Caenorhabditis elegans.
PLoS Genet. 2012 8(11) e1003092 
[ PubMed ID = 23209443 ] [ RRC reference ]